Latest PUBLICATIONS

  • Morbidity of teeth in the line of the fracture.
    Publication Date: 01/05/2011, on Minerva stomatologica
    by Mangone G, Longo F, Friscia M, Ferrara S, Califano L
    DOI:

    Management of a jaw fracture in which a tooth lies in the fracture line is controversial. In the past, teeth were generally removed because they were thought to be the cause of infections or locus minoris resistentiae. To provide a better indication in the management of teeth in the fracture line and the relate complications we retrospectively reviewed the files particularly in relation to treatment options.

  • Resveratrol reduces the invasive growth and promotes the acquisition of a long-lasting differentiated phenotype in human glioblastoma cells.
    Publication Date: 27/04/2011, on Journal of agricultural and food chemistry
    by Castino R, Pucer A, Veneroni R, Morani F, Peracchio C, Lah TT, Isidoro C
    DOI: 10.1021/jf104917q

    Malignant glioblastoma represents a challenge in the chemotherapy of brain tumors, because of its aggressive behavior characterized by chemoresistance, infiltrative diffusion, and high rate of recurrence and death. In this study, we used cultured human U87MG cells and primary human glioblastoma cultures to test the anticancer properties of resveratrol (RV), a phytoalexin abundantly present in a variety of dietary products. In U87MG cells, 100 μM RV elicited cell growth arrest by 48 h and bax-mediated cell toxicity by 96 h and greatly limited cell migration and invasion through matrigel. Both in U87MG cells and in primary glioblastoma cultures, the chronic administration of RV (100 μM for up to 96 h) decreased the expression of nestin (a brain (cancer) stem cells marker) but increased that of glial acidic fibrillary protein (a mature glial cell marker) and of βIII-tubulin (a neuronal differentiation marker). Chronic treatment with RV increased the proportion of cells positive for senescence-associated β-galactosidase activity. This is the first report showing the ability of RV to induce glial-like and neuronal-like differentiation in glioblastoma cells. The beneficial effects of chronic RV supplementation lasted up to 96 h after its withdrawal from the culture medium. The present findings support the introduction of pulsed administration of this food-derived molecule in the chemotherapy regimen of astrocytomas.

  • Neurosporaside, a tetraglycosylated sphingolipid from Neurospora crassa.
    Publication Date: 25/04/2011, on Journal of natural products
    by Costantino V, Mangoni A, Teta R, Kra-Oz G, Yarden O
    DOI: 10.1021/np1009493

    The new tetraglycosylceramide neurosporaside (1a) has been isolated from the fungus Neurospora crassa. Neurosporaside is a tetraglycosylated glycosphingolipid characterized by a sugar chain unprecedented among natural glycoconjugates. The structure of neurosporaside was elucidated by extensive spectroscopic analysis and microscale degradation analysis, which allowed full structure elucidation using less than 1 mg of compound.

  • Targeting G-quadruplex structure in the human c-Kit promoter with short PNA sequences.
    Publication Date: 20/04/2011, on Bioconjugate chemistry
    by Amato J, Pagano B, Borbone N, Oliviero G, Gabelica V, Pauw ED, D'Errico S, Piccialli V, Varra M, Giancola C, Piccialli G, Mayol L
    DOI: 10.1021/bc100444v

    The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".

  • A novel ErbB2 epitope targeted by human antitumor immunoagents.
    Publication Date: 01/04/2011, on The FEBS journal
    by Troise F, Monti M, Merlino A, Cozzolino F, Fedele C, Russo Krauss I, Sica F, Pucci P, D'Alessio G, De Lorenzo C
    DOI: 10.1111/j.1742-4658.2011.08041.x

    Two novel human antitumor immunoconjugates, engineered by fusion of a single-chain antibody fragment against human ErbB2 receptor, termed Erbicin, with either a human RNase or the Fc region of a human IgG(1) , are selectively cytotoxic for ErbB2-positive cancer cells in vitro and in vivo. These Erbicin-derived immunoagents (EDIAs) do not show the most negative properties of Herceptin, the only humanized mAb against ErbB2 used in the therapy of breast carcinoma: cardiotoxicity and the inability to act on resistant tumors. These differences are probably attributable to the different ErbB2 epitopes recognized by EDIAs and Herceptin, respectively, as we have previously reported that they induce different signaling mechanisms that control tumor and cardiac cell viability. Thus, to accurately identify the novel epitope recognized by EDIAs, three independent and complementary methodologies were used. They gave coherent results, which are reported here: EDIAs bind to a different ErbB2 epitope than Herceptin and the other human/humanized antibodies against ErbB2 reported so far. The epitope has been successfully located in region 122-195 of extracellular domain I. These findings could lead to the identification of novel epitopes on ErbB2 that could be used as potential therapeutic targets to mitigate anti-ErbB2-associated cardiotoxicity and eventually overcome resistance.

  • Comparative neuropsychological profile of pathological gambling, hypersexuality, and compulsive eating in Parkinson's disease.
    Publication Date: 01/04/2011, on Movement disorders : official journal of the Movement Disorder Society
    by Vitale C, Santangelo G, Trojano L, Verde F, Rocco M, Grossi D, Barone P
    DOI: 10.1002/mds.23567

    Impulse control disorders (ICDs), in particular pathological gambling, hypersexuality, and compulsive eating, are being increasingly identified in Parkinson's disease (PD) patients. Pathological gambling has been associated with frontal/executive dysfunctions, whereas hypersexuality and compulsive eating, and their relation with cognitive dysfunctions, have not been investigated in PD.

  • Hypolipemic and hypoglycaemic activity of bergamot polyphenols: from animal models to human studies.
    Publication Date: 01/04/2011, on Fitoterapia
    by Mollace V, Sacco I, Janda E, Malara C, Ventrice D, Colica C, Visalli V, Muscoli S, Ragusa S, Muscoli C, Rotiroti D, Romeo F
    DOI: 10.1016/j.fitote.2010.10.014

    Bergamot juice produces hypolipemic activity in rats though the mechanism remains unclear. Here we investigated on the effect of bergamot extract (BPF) in diet-induced hyperlipemia in Wistar rats and in 237 patients suffering from hyperlipemia either associated or not with hyperglycaemia. BPF, given orally for 30 days to both rats and patients, reduces total and LDL cholesterol levels (an effect accompanied by elevation of cHDL), triglyceride levels and by a significant decrease in blood glucose. Moreover, BPF inhibited HMG-CoA reductase activity and enhanced reactive vasodilation thus representing an efficient phytotherapeutic approach in combating hyperlipemic and hyperglycaemic disorders.

  • Deamidation at asparagine and glutamine as a major modification upon deterioration/aging of proteinaceous binders in mural paintings.
    Publication Date: 15/03/2011, on Analytical chemistry
    by Leo G, Bonaduce I, Andreotti A, Marino G, Pucci P, Colombini MP, Birolo L
    DOI: 10.1021/ac1027275

    Proteomic strategies are herein proved to be a complementary approach to the well established amino acid composition analysis for the characterization of the aging and deterioration phenomena occurring to proteinaceous materials in works-of-art. Amino acid analyses on several samples demonstrated that proteins in the frescoes from the Camposanto Monumentale in Pisa are deteriorated as revealed by the decrease in Met, Lys, and Tyr content and by the presence in all the samples of amino malonic acid as a result of Ser, Phe, and Cys oxidation. Proteomic analysis identified deamidation at Asn and Gln as a further major event occurred. This work paves the way to the exploitation of proteomic strategies for the investigation of the molecular effects of aging and deterioration in historical objects. Results show that proteomic searches for deamidation by liquid chromatography-tandem mass spectrometry (LC-MS/MS) could constitute a routine analysis for paintings or any artistic and historic objects where proteins are present. Peptides that can be used as molecular markers when casein is present were identified.

  • Molecular and clinical characterization of albinism in a large cohort of Italian patients.
    Publication Date: 14/03/2011, on Investigative ophthalmology & visual science
    by Gargiulo A, Testa F, Rossi S, Di Iorio V, Fecarotta S, de Berardinis T, Iovine A, Magli A, Signorini S, Fazzi E, Galantuomo MS, Fossarello M, Montefusco S, Ciccodicola A, Neri A, Macaluso C, Simonelli F, Surace EM
    DOI: 10.1167/iovs.10-6091

    The purpose of this study was to identify the molecular basis of albinism in a large cohort of Italian patients showing typical ocular landmarks of the disease and to provide a full characterization of the clinical ophthalmic manifestations.

  • Selective and integrated rehabilitation programs for disturbances of visual/spatial attention and executive function after brain damage: a neuropsychological evidence-based review.
    Publication Date: 01/03/2011, on European journal of physical and rehabilitation medicine
    by Zoccolotti P, Cantagallo A, De Luca M, Guariglia C, Serino A, Trojano L
    DOI:

    The present evidence-based review systematically examines the literature on the neuropsychological rehabilitation of attentional and executive dysfunctions in patients with acquired brain lesions. Four areas are considered: 1) neuropsychological rehabilitation of attentional disorders; 2) neuropsychological rehabilitation of neglect disorders; 3) neuropsychological rehabilitation of dysexecutive disorders and 4) rehabilitation trainings for patients with mild traumatic brain injury (TBI). In each area, search and selection of papers were performed on several databases and integrated by crosschecking references from relevant and recent reviews. The literature up to 2007 was examined (in some areas the search was limited from 2000 to 2007). Class of evidence for each selected study was evaluated according to the SPREAD (2010) criteria. Based on this analysis, recommendations on the effectiveness of rehabilitation trainings are proposed separately for each rehabilitation method in each of the four areas considered. Information on follow-up data and impact on activities of daily living is provided whenever available.

  • Reactive astrocytosis-induced perturbation of synaptic homeostasis is restored by nerve growth factor.
    Publication Date: 01/03/2011, on Neurobiology of disease
    by Cirillo G, Bianco MR, Colangelo AM, Cavaliere C, Daniele de L, Zaccaro L, Alberghina L, Papa M
    DOI: 10.1016/j.nbd.2010.11.012

    Reactive gliosis has been implicated in both inflammatory and neurodegenerative diseases. However, mechanisms by which astrocytic activation affects synaptic efficacy have been poorly elucidated. We have used the spared nerve injury (SNI) of the sciatic nerve to induce reactive astrocytosis in the lumbar spinal cord and investigate its potential role in disrupting the neuro-glial circuitry. Analysis of spinal cord sections revealed that SNI was associated with an increase of microglial (Iba1) and astrocytic (GFAP) markers. These changes, indicative of reactive gliosis, were paralleled by (i) a decrease of glial amino acid transporters (GLT1 and GlyT1) and increased levels of (ii) neuronal glutamate transporter EAAC1, (iii) neuronal vesicular GABA transporter (vGAT) and (iv) the GABAergic neuron marker GAD65/67. Besides the increase of Glutamate/GABA ratio, indicative of the perturbation of synaptic circuitry homeostasis, the boost of glutamate also compromised glial function in neuroprotection by up-regulating the xCT subunit of the glutamate-cystine antiport system and reducing glutathione (GSH) production. Finally, this study also shows that all these structural changes were linked to an alteration of endogenous NGF metabolism, as demonstrated by the decrease of endogenous NGF expression levels and increased activity of the NGF-degrading metalloproteinases. All the changes displayed by SNI-animals were reversed by a 7-days i.t. administration of NGF or GM6001, a generic metalloproteinase inhibitor, as compared to vehicle (ACSF)-treated animals. All together, these data strongly support the correlation between reactive astrogliosis and mechanisms underlying the perturbation of the synaptic circuitry in the SNI model of peripheral nerve injury, and the essential role of NGF in restoring both synaptic homeostasis and the neuroprotective function of glia.

  • Quantitative neuroproteomics: classical and novel tools for studying neural differentiation and function.
    Publication Date: 01/03/2011, on Stem cell reviews
    by Colucci-D'Amato L, Farina A, Vissers JP, Chambery A
    DOI: 10.1007/s12015-010-9136-3

    Mechanisms underlying neural stem cell proliferation, differentiation and maturation play a critical role in the formation and wiring of neuronal connections. This process involves the activation of multiple serial events, which guide the undifferentiated cells to different lineages via distinctive developmental programs, forming neuronal circuits and thus shaping the adult nervous system. Furthermore, alterations within these strictly regulated pathways can lead to severe neurological and psychiatric diseases. In this framework, the investigation of the high dynamic protein expression changes and other factors affecting protein functions, for example post-translational modifications, the alterations of protein interaction networks, is of pivotal importance for the understanding of the molecular mechanisms responsible for cell differentiation. More recently, proteomic studies in neuroscience ("neuroproteomics") are receiving increased interest for the primary understanding of the regulatory networks underlying neuronal differentiation processes. Besides the classical two-dimensional-based proteomic strategies, the emerging platforms for LC-MS shotgun proteomic analysis hold great promise in unraveling the molecular basis of neural stem cell differentiation. In this review, recent advancements in label-free LC-MS quantitative neuroproteomics are highlighted as a new tool for the study of neural differentiation and functions, in comparison to mass spectrometry-based labeling approaches. The more commonly used protein profiling strategies and model systems for the analysis of neural differentiation are also discussed, along with the challenging proteomic approaches aimed to analyze the nervous system-specific organelles, the neural cells secretome and the specific protein interaction networks.

  • Krüppel-like factor 7 is required for olfactory bulb dopaminergic neuron development.
    Publication Date: 15/02/2011, on Experimental cell research
    by Caiazzo M, Colucci-D'Amato L, Volpicelli F, Speranza L, Petrone C, Pastore L, Stifani S, Ramirez F, Bellenchi GC, di Porzio U
    DOI: 10.1016/j.yexcr.2010.11.006

    Krüppel-like factor 7 (KLF7) belongs to the large family of KLF transcription factors, which comprises at least 17 members. Within this family, KLF7 is unique since its expression is strictly restricted within the nervous system during development. We have previously shown that KLF7 is required for neuronal morphogenesis and axon guidance in selected regions of the nervous system, including hippocampus, olfactory bulbs and cortex, as well as in neuronal cell cultures. In the present work, we have furthered our analysis of the role of KLF7 in central nervous system development. By gene expression analysis during brain embryogenesis, we found significant alterations in dopaminergic neurons in Klf7 null mice. In particular, the tyrosine hydroxylase (TH) and dopamine transporter (Dat) transcripts are strongly decreased in the olfactory bulbs and ventral midbrain at birth, compared to wild-type littermates. Interestingly, Klf7-mutant mice show a dramatic reduction of TH-positive neurons in the olfactory bulbs, but no change in GABAergic or midbrain dopaminergic neurons. These observations raise the possibility that a lack of a KLF family member affects dopaminergic neuron development.

  • Nanostructuring of CyPLOS (Cyclic Phosphate-Linked OligoSaccharides), novel saccharide-based synthetic ion transporters.
    Publication Date: 15/02/2011, on Journal of colloid and interface science
    by Mangiapia G, Coppola C, Vitiello G, D'Errico G, De Napoli L, Radulescu A, Montesarchio D, Paduano L
    DOI: 10.1016/j.jcis.2010.10.060

    Ionophores are an important class of synthetic molecules which mimic natural ion channels or carriers. Here we report the aggregation behavior in pseudo-physiological environment of three Cyclic Phosphate-Linked Oligosaccharides (CyPLOS) derivatives, synthetic ion transporters based on cyclic, phosphate-linked disaccharide skeleton differing for the nature of the tails (tetraethylene-TEG glycol and/or n-undecyl chains) attached to the C-2 and C-3 of the constitutive monosaccharides. Their aggregation behavior has been studied by a combined use of dynamic light scattering (DLS), electron paramagnetic resonance spectroscopy (EPR) and Small Angle Neutron Scattering (SANS). DLS measurements were performed to reveal the formation and size distribution of the CyPLOS aggregates. EPR measurements, by using 5-doxyl stearic acid (5-DSA) as spin-probe, showed that the aggregates are mainly due to the formation of double layers and allowed to analyze the local fluidity. Finally, SANS measurements allowed estimating the layer thickness of the double layers. Our results indicate that the three CyPLOS analogs show self-aggregation properties that depend on the different nature of the inserted tails.

  • The new carotenoid pigment moraxanthin is associated with toxic microalgae.
    Publication Date: 10/02/2011, on Marine drugs
    by Mangoni O, Imperatore C, Tomas CR, Costantino V, Saggiomo V, Mangoni A
    DOI: 10.3390/md9020242

    The new pigment "moraxanthin" was found in natural samples from a fish mortality site in the Inland Bays of Delaware, USA. Pure cultures of the species, tentatively named Chattonella cf. verruculosa, and natural samples contained this pigment as a dominant carotenoid. The pigment, obtained from a 10 L culture of C. cf. verruculosa, was isolated and harvested by HPLC and its structure determined from MS and 1D- and 2D-NMR. The data identified this pigment as a new acylated form of vaucheriaxanthin called moraxanthin after the berry like algal cell. Its presence in pure cultures and in natural bloom samples indicates that moraxanthin is specific to C. cf. verruculosa and can be used as a marker of its presence when HPLC is used to analyze natural blooms samples.