| Name | Concetta |
| Surname | Giancola |
| Institution | University of Naples – Federico II |
| concetta.giancola@unina.it | |
| Address | Department of Pharmacy, University of Napoli Federico II, Via D. Montesano 49, 80131, Napoli, Italy; InterUniversity Center for Research in Neurosciences, University of Campania "Luigi Vanvitelli", Napoli, Italy |
Nowadays, the molecular basis of interaction between low molecular weight compounds and biological macromolecules is the subject of numerous investigations aimed at the rational design of molecules with specific therapeutic applications. In the last decades, it has been demonstrated that DNA quadruplexes play a critical role in several biological processes both at telomeric and gene promoting levels thus providing a great stride in the discovery of ligands able to interact with such a biologically relevant DNA conformation. So far, a number of experimental and computational approaches have been successfully employed in order to identify new ligands and to characterize their binding to the DNA. The main focus of this review is the description of these methodologies, placing a particular emphasis on computational methods, isothermal titration calorimetry (ITC), mass spectrometry (MS), nuclear magnetic resonance (NMR), circular dichroism (CD) and fluorescence spectroscopies.
G-quadruplex formation in the sequences 5'-(TTAGGG)(n) and 5'(TTAGGG)(n)TT (n = 4, 8, 12) was studied using circular dichroism, sedimentation velocity, differential scanning calorimetry, and molecular dynamics simulations. Sequences containing 8 and 12 repeats formed higher-order structures with two and three contiguous quadruplexes, respectively. Plausible structures for these sequences were determined by molecular dynamics simulations followed by experimental testing of predicted hydrodynamic properties by sedimentation velocity. These structures featured folding of the strand into contiguous quadruplexes with mixed hybrid conformations. Thermodynamic studies showed the strands folded spontaneous to contain the maximum number contiguous quadruplexes. For the sequence 5'(TTAGGG)(12)TT, more than 90% of the strands contained completely folded structures with three quadruplexes. Statistical mechanical-based deconvolution of thermograms for three quadruplex structures showed that each quadruplex melted independently with unique thermodynamic parmameters. Thermodynamic analysis revealed further that quadruplexes in higher-ordered structures were destabilized relative to their monomeric counterparts, with unfavorable coupling free energies. Quadruplex stability thus depends critically on the sequence and structural context.
A series of trisubstituted naphthalimides have been synthesized and evaluated as telomeric G-quadruplex ligands by biophysical methods. Affinity for telomeric G-quadruplex AGGG(TTAGGG)(3) binding was first screened by fluorescence titrations. Subsequently, the interaction of the telomeric G-quadruplex with compounds showing the best affinity has been studied by isothermal titration calorimetry and UV-melting experiments. The two best compounds of the series tightly bind the telomeric quadruplex with a 2:1 drug/DNA stoichiometry. These derivatives have been further evaluated for their ability to inhibit telomerase by a TRAP assay and their pharmacological properties by treating melanoma (M14) and human lung cancer (A549) cell lines with increasing drug concentrations. A dose-dependent inhibition of cell proliferation was observed for all cellular lines during short-term treatment.
Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR structure. The X-ray structure of the complex between TBA and human α-thrombin was solved at 2.9-Å resolution, but did not provide details of the aptamer conformation and the interactions with the protein molecule. TBA is rapidly processed by nucleases. To improve the properties of TBA, a number of modified analogs have been produced. In particular, a modified TBA containing a 5'-5' polarity inversion site, mTBA, has higher stability and higher affinity toward thrombin with respect to TBA, although it has a lower inhibitory activity. We present the crystal structure of the thrombin-mTBA complex at 2.15-Å resolution; the resulting model eventually provides a clear picture of thrombin-aptamers interaction, and also highlights the structural bases of the different properties of TBA and mTBA. Our findings open the way for a rational design of modified aptamers with improved potency as anticoagulant drugs.
Human telomeric G-quadruplex structures are known to be promising targets for an anticancer therapy. In the past decade, several research groups have been focused on the design of new ligands trying to optimize the interactions between these small molecules and the G-quadruplex motif. In most of these studies, the target structures were the single quadruplex units formed by short human DNA telomeric sequences (typically 21-26 nt). However, the 3'-terminal single-stranded human telomeric DNA is actually 100-200 bases long and can form higher-order structures by clustering several consecutive quadruplex units (multimers). Despite the increasing number of structural information on longer DNA telomeric sequences, very few data are available on the binding properties of these sequences compared with the shorter DNA telomeric sequences. In this paper we use a combination of spectroscopic (CD, UV and fluorescence) and calorimetric techniques (ITC) to compare the binding properties of the (TTAGGG)(8)TT structure formed by two adjacent quadruplex units with the binding properties of the (AG(3)TT)(4) single quadruplex structure. The three side-chained triazatruxene derivative azatrux and TMPyP4 cationic porphyrin were used as quadruplex ligands. We found that, depending on the drug, the number of binding sites per quadruplex unit available in the multimer structure was smaller or greater than the one expected on the basis of the results obtained from individual quadruplex binding studies. This work suggests that the quadruplex units along a multimer structure do not behave as completely independent. The presence of adjacent quadruplexes results in a diverse binding ability not predictable from single quadruplex binding studies. The existence of quadruplex-quadruplex interfaces in the full length telomeric overhang may provide an advantageous factor in drug design to enhance both affinity and selectivity for DNA telomeric quadruplexes.
The present study has employed a combination of spectroscopic, calorimetric and computational methods to explore the binding of the three side-chained triazatruxene derivative, termed azatrux, to a human telomeric G-quadruplex sequence, under conditions of molecular crowding. The binding of azatrux to the tetramolecular parallel [d(TGGGGT)](4) quadruplex in the presence and absence of crowding conditions, was also characterized. The data indicate that azatrux binds in an end-stacking mode to the parallel G-quadruplex scaffold and highlights the key structural elements involved in the binding. The selectivity of azatrux for the human telomeric G-quadruplex relative to another biologically relevant G-quadruplex (c-Kit87up) and to duplex DNA was also investigated under molecular crowding conditions, showing that azatrux has good selectivity for the human telomeric G-quadruplex over the other investigated DNA structures.
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".
Bovine seminal ribonuclease (BS-RNase), a homodimeric protein displaying selective cytotoxicity towards tumor cells, is isolated as a mixture of two isoforms, a dimeric form in which the chains swap their N-termini, and an unswapped dimer. In the cytosolic reducing environment, the dimeric form in which the chains swap their N-termini is converted into a noncovalent dimer (termed NCD), in which the monomers remain intertwined through their N-terminal ends. The quaternary structure renders the reduced protein resistant to the ribonuclease inhibitor, a protein that binds most ribonucleases with very high affinity. On the other hand, upon selective reduction, the unswapped dimer is converted in two monomers, which are readily bound and inactivated by the ribonuclease inhibitor. On the basis of these considerations, it has been proposed that the cytotoxic activity of BS-RNase relies on the 3D structure and stability of its NCD derivative. Here, we report a comparison of the thermodynamic and chemical stability of the NCD form of BS-RNase with that of the monomeric derivative, together with an investigation of the thermal dissociation mechanism revealing the presence of a dimeric intermediate. In addition, we report that the replacement of of Arg80 by Ser significantly decreases the cytotoxic activity of BS-RNase and the stability of the NCD form with respect to the parent protein, but does not affect the ribonucleolytic activity or the dissociation mechanism. The data show the importance of Arg80 for the cytotoxicity of BS-RNase, and also support the hypothesis that the reduced derivative of BS-RNase is responsible for its cytotoxic activity.
Guanine-rich nucleic acid sequences can adopt G-quadruplex structures stabilized by layers of four Hoogsteen-paired guanine residues. Quadruplex-prone sequences are found in many regions of human genome and in the telomeres of all eukaryotic organisms. Since small molecules that target G-quadruplexes have been found to be effective telomerase inhibitors, the identification of new specific ligands for G-quadruplexes is emerging as a promising approach to develop new anticancer drugs. Distamycin A is known to bind to AT-rich sequences of duplex DNA, but it has recently been shown to interact also with G-quadruplexes. Here, isothermal titration calorimetry (ITC) and NMR techniques have been employed to characterize the interaction between a dicationic derivative of distamycin A (compound 1) and the [d(TGGGGT)](4) quadruplex. Additionally, to compare the binding behaviour of netropsin and compound 1 to the same target, a calometric study of the interaction between netropsin and [d(TGGGGT)](4) has been performed. Experiments show that netropsin and compound 1 are able to bind to [d(TGGGGT)](4) with good affinity and comparable thermodynamic profiles. In both cases the interactions are entropically driven processes with a small favourable enthalpic contribution. Interestingly, the structural modifications of compound 1 decrease the affinity of the ligand toward the duplex, enhancing the selectivity.
The study of DNA G-quadruplex stabilizers has enjoyed a great momentum in the late years due to their application as anticancer agents. The recognition of the grooves of these structural motifs is expected to result in a higher degree of selectivity over other DNA structures. Therefore, to achieve an enhanced knowledge on the structural and conformational requisites for quadruplex groove recognition, distamycin A, the only compound for which a pure groove binding has been proven, has been chemically modified. Surprisingly, structural and thermodynamic studies revealed that the absence of Coulombic interactions results in an unprecedented binding position in which both the groove and the 3' end of the DNA are occupied. This further contribution adds another piece to the so far elusive puzzle of the recognition between ligands and DNA quadruplexes and will serve as a platform for a rational design of new groove binders.