| Name | Bruno |
| Surname | Pagano |
| Institution | University of Naples – Federico II |
| bruno.pagano@unina.it | |
| Address | Department of Pharmacy, University of Naples "Federico II", Via D. Montesano 49, 80131, Naples, Italy |
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".
Guanine-rich nucleic acid sequences can adopt G-quadruplex structures stabilized by layers of four Hoogsteen-paired guanine residues. Quadruplex-prone sequences are found in many regions of human genome and in the telomeres of all eukaryotic organisms. Since small molecules that target G-quadruplexes have been found to be effective telomerase inhibitors, the identification of new specific ligands for G-quadruplexes is emerging as a promising approach to develop new anticancer drugs. Distamycin A is known to bind to AT-rich sequences of duplex DNA, but it has recently been shown to interact also with G-quadruplexes. Here, isothermal titration calorimetry (ITC) and NMR techniques have been employed to characterize the interaction between a dicationic derivative of distamycin A (compound 1) and the [d(TGGGGT)](4) quadruplex. Additionally, to compare the binding behaviour of netropsin and compound 1 to the same target, a calometric study of the interaction between netropsin and [d(TGGGGT)](4) has been performed. Experiments show that netropsin and compound 1 are able to bind to [d(TGGGGT)](4) with good affinity and comparable thermodynamic profiles. In both cases the interactions are entropically driven processes with a small favourable enthalpic contribution. Interestingly, the structural modifications of compound 1 decrease the affinity of the ligand toward the duplex, enhancing the selectivity.
The study of DNA G-quadruplex stabilizers has enjoyed a great momentum in the late years due to their application as anticancer agents. The recognition of the grooves of these structural motifs is expected to result in a higher degree of selectivity over other DNA structures. Therefore, to achieve an enhanced knowledge on the structural and conformational requisites for quadruplex groove recognition, distamycin A, the only compound for which a pure groove binding has been proven, has been chemically modified. Surprisingly, structural and thermodynamic studies revealed that the absence of Coulombic interactions results in an unprecedented binding position in which both the groove and the 3' end of the DNA are occupied. This further contribution adds another piece to the so far elusive puzzle of the recognition between ligands and DNA quadruplexes and will serve as a platform for a rational design of new groove binders.
The nature of the binding mode and stoichiometry of the TMPyP4 cationic porphyrin to G-quadruplex structures continues to be controversial, with no consensus model to date, especially for intramolecular G-quadruplexes from human telomeric sequences. Those sequences possess intricate polymorphism in solution that appears to be reduced under molecular crowding conditions in which the parallel structure appears to be the most populated one. We have performed a systematic study, in dilute solution and under molecular crowding conditions, of the binding reactions between TMPyP4 and four G-quadruplexes formed by different truncations of human telomeric DNA, with 5'- or 3'-flanking bases, using isothermal titration calorimetry and circular dichroism. The results clearly indicate that all of these G-quadruplexes are able to bind up to four TMPyP4 molecules. CD studies show that interaction with TMPyP4 promotes the conversion of the hybrid structures to an antiparallel conformation in dilute solution, while under molecular crowding conditions the interaction does not promote any conformational change. ITC reveals in both cases that the binding process comprises two sequential events, a first in which one molecule of TMPyP4 interacts with the quadruplex structures and a second in which three other molecules bind to the structures. The selectivity of TMPyP4 for the quadruplex relative to duplex DNA was also investigated under molecular crowding conditions showing that TMPyP4 has enhanced selectivity for quadruplex DNA compared to the duplex structure. This finding reinforces the potential applications of TMPyP4.
G-quadruplexes are higher-order nucleic acids structures formed by G-rich sequences that are stabilized by tetrads of hydrogen-bonded guanine bases. Recently, there has been growing interest in the study of G-quadruplexes because of their possible involvement in many biological processes. Isothermal titration calorimetry (ITC) has been proven to be a useful tool to study the energetic aspects of G-quadruplex interactions. Particularly, ITC has been applied many times to determine the thermodynamic properties of drug-quadruplex interactions to screening among various drugs and to address drug design. In the present review, we will focus on the ITC studies of G-quadruplex structures and their interaction with proteins and drugs and the most significant results will be discussed.
Molecular dynamics simulations have been used to study the differences between two DNA and RNA 14-mer quadruplexes of analogous sequences. Their structures present a completely different fold: DNA forms a bimolecular quadruplex containing antiparallel strands and diagonal loops; RNA forms an intrastrand parallel quadruplex containing a G-tetrad and an hexad, which dimerizes by hexad stacking. We used a multiscale computational approach combining classical Molecular dynamics simulations and density functional theory calculations to elucidate the difference in stability of the 2-folds and their ability in coordinating cations. The presence of 2'-OH groups in the RNA promotes the formation of a large number of intramolecular hydrogen bonds that account for the difference in fold and stability of the two 14-mers. We observe that the adenines in the RNA quadruplex play a key role in conserving the geometry of the hexad. We predict the cation coordination mode of the two quadruplexes, not yet observed experimentally, and we offer a rationale for the corresponding binding energies involved.
The use of small molecules that bind and stabilize G-quadruplex structures is emerging as a promising way to inhibit telomerase activity in tumor cells. In this paper, isothermal titration calorimetry (ITC) and 1H NMR studies have been conducted to examine the binding of distamycin A and its two carbamoyl derivatives (compounds 1 and 2) to the target [d(TGGGGT)]4 and d[AG3(T2AG3)3] quadruplexes from the Tetrahymena and human telomeres, respectively. The interactions were examined using two different buffered solutions containing either K+ or Na+ at a fixed ionic strength, to evaluate any influence of the ions present in solution on the binding behaviour. Experiments reveal that distamycin A and compound 1 bind the investigated quadruplexes in both solution conditions; conversely, compound 2 appears to have a poor affinity in any case. Moreover, these studies indicate that the presence of different cations in solution affects the stoichiometry and thermodynamics of the interactions.
Aptamer-based drugs represent an attractive approach in pharmacological therapy. The most studied aptamer, thrombin binding aptamer (TBA), folds into a well-defined quadruplex structure and binds to its target with good specificity and affinity. Modified aptamers with improved biophysical properties could constitute a new class of therapeutic aptamers. In this study we show that the modified thrombin binding aptamer (mTBA), (3')GGT(5')-(5')TGGTGTGGTTGG(3'), which also folds into a quadruplex structure, is more stable than its unmodified counterpart and shows a higher thrombin affinity. The stability of the modified aptamer was investigated using differential scanning calorimetry, and the energetics of mTBA and TBA binding to thrombin was characterized by means of isothermal titration calorimetry (ITC). ITC data revealed that TBA/thrombin and mTBA/thrombin binding stoichiometry is 1:2 for both interactions. Structural models of the two complexes of thrombin with TBA and with mTBA were also obtained and subjected to molecular dynamics simulations in explicit water. Analysis of the models led to an improvement of the understanding of the aptamer-thrombin recognition at a molecular level.
The complex between distamycin A and the parallel DNA quadruplex [d(TGGGGT)]4 has been studied by 1H NMR spectroscopy and isothermal titration calorimetry (ITC). To unambiguously assert that distamycin A interacts with the grooves of the quadruplex [d(TGGGGT)]4, we have analyzed the NMR titration profile of a modified quadruplex, namely [d(TGGMeGGT)]4, and we have applied the recently developed differential frequency-saturation transfer difference (DF-STD) method, for assessing the ligand-DNA binding mode. The three-dimensional structure of the 4:1 distamycin A/[d(TGGGGT)]4 complex has been determined by an in-depth NMR study followed by dynamics and mechanics calculations. All results unequivocally indicate that distamycin molecules interact with [d(TGGGGT)]4 in a 4:1 binding mode, with two antiparallel distamycin dimers that bind simultaneously two opposite grooves of the quadruplex. The affinity between distamycin A and [d(TGGGGT)]4 enhances ( approximately 10-fold) when the ratio of distamycin A to the quadruplex is increased. In this paper we report the first three-dimensional structure of a groove-binder molecule complexed to a DNA quadruplex structure.
Immortality of tumour cells is strictly correlated to telomerase activity. Telomerase is overexpressed in about 85% of tumour cells and maintains telomere length contributing to cell immortalisation, whereas in somatic cells telomeres progressively shorten until cell death occurs by apoptosis. Different drugs can promote telomeric G-rich overhangs which fold into quadruplex structures that inhibit telomerase activity. Detailed studies on drug-quadruplex complexes are essential to understand quadruplex recognition and address drug design. This review will discuss the energetic aspects of quadruplex-drug interactions with a particular attention to physico-chemical methodologies.